- To what carbon is the hydroxyl-group connected that reacts with the phosphate group of another nucleotide to form a polymer?Nucleotides have a phosphate group attached to a sugar at the carbon labeled
- What is the difference in hydrogen bonding between A/T pairs verses G/C pairs?
- which of the following is an example of constitutive heterochromatin
- In the following DNA molecule, how many 3' hydroxyls are present?AATAGCGGATGCCCGAATACGAGTTATCGCCTACGGGCTTATGCTC
- the structure of a cell that contains the genetic information is called a
- Which structural component of a eukaryotic chromosome is the attachment point for the spindles during cell division
- A form of a gene that has a slightly different sequence than other forms of the same gene but encodes the same type of RNA or protein, is called a(n)
- the two strands of a DNA molecule are held together by
- which of the following structures would not be found in prokaryotic cells
- The bond that connects the nucleotides in a nucleic acid strand is a
- In order to be functional, a eukaryotic chromosome requires all of the following except
- Thirty percent of the bases in DNA of the bacterium Pseudomonas is adenine. What percentage of cytosine presents in this DNA?
- In reciting a list of bases along the length of a nucleic acid strand we proceed in the direction of the
- Genetically speaking, prokaryotes are different from eukaryotes because:
- The two strands of a DNA molecule are said to be opposite. To what property of the DNA molecule does this characteristic refer?
- The politics of immigration looms very large for _____ concentrated in the Southwest.
- The notation PA A T C C G TOH represents a nucleic acid strand of a DNA molecule in which A, T, C, and G are the nucleotides and "P" and "OH" are the free phosphate- and hydroxyl group, respectively. What is the nucleotide sequence of the complementary strand?
- when the phosphate group of one nucleotide binds to the hydroxyl group of another nucleotide, the bond is called a
- Wearing an article of clothing to show solidarity with a group is an example of
- Cyclic nitrogenous bases in which 6-membered ring is connected to a 5-membered ring are called