- T or FGene duplications have no effect on evolution
- what molecule contains an anitcodon
- Following transcription, the RNA has a complementary sequence to
- The enzyme that accomplishes transcription is termed
- How many amino acids are encoded by the following mRNA?5′GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3′
- Which of the following drives the production of ATP from ADP and Pi by ATP synthase?
- What form of RNA encodes the sequence of amino acids for a functional protein
- What process is important for the initiation of translation
- A protein called actin consists of 376 amino acids. The mRNA for actin must be longer than
- in eukaryotic organisms, what RNA modification is important for mRNA stability
- Inhibitory neurotransmitters such as glycine and GABA make a postsynaptic cell harder to depolarize by allowing what?
- regulatory transcription factors may be regulated by
- T or FThe differences between two homologous genes are the result of random mutations accumulated over the course of many generations
- Homologous genes within a single species are said to be
- What is the outcome of point mutation?a. normal splicingb. intron 1 is not splicedc. exon 2 is skipped
- Determine whether the following statement is true or false: Communication between neurons involves an interconversion of electrical and chemical signals.
- In the technique called optogenetics, light-gated Na+ channels are introduced into the brains of living animals. Activation of these channels by light can depolarize the membranes of neurons that contain them, selectively activating these target cells.Since its inception, optogenetics has been expanded to include other types of light-gated channels, such as a channel that is selective for Cl- instead of Na+. If this light-gated Cl- channel were introduced into neurons in a region of the brain that stimulates feeding, what might you expect to see?
- the production of gene families, such as globin genes is the result of
- what gene chains take part in gene duplication?
- Antimycin A is a piscicide (fish poison) used to manage fisheries and kill invasive species. Antimycin A blocks the transfer of electrons through the cytochrome b-c1 complex. What components of the electron transport chain are bound to high-energy electrons after treating a mitochondrion with antimycin A?