Back to Questions
Want to know:
This was the name for the Protestant revival in the United States that took place from roughly the 1790s to the 1840s
Get a detailed, AI-powered explanation for this question and thousands more on StudyFetch.
Get the Answer for FreeHow StudyFetch Helps You Master This Topic
AI-Powered Answers
Get instant, detailed explanations powered by AI that understands your course material.
Deep Understanding
Go beyond surface-level answers with step-by-step breakdowns and examples.
Personalized Learning
Sparky adapts to your learning style and helps you connect ideas.
Practice & Test
Turn any question into flashcards, quizzes, and practice tests to solidify your knowledge.
Explore More Questions
- "Oh he sits high in all the people's heart and that which would appear offense in us his countenance, like richest alchemy will change to virtue and to worthiness"
- At each __________ , a four-nucleotide sequence is repeated many times in a row. The number of repeats varies widely within the human population. For example: AGATAGATAGATAGATAGAT
- . By the end of 1991, what was the state of the Soviet Union? a. It remained firmly under Communist control, despite communism's collapse in Eastern Europe. b. It had fallen apart, as most of its fifteen republics had proclaimed their independence. c. It still had the largest nuclear arsenal and therefore remained the dominant military superpower for over two decades. d. It enjoyed a booming economy due to trade with the United States and its stable leadership. e. It was torn by civil war, as Gorbachev led a group of military leaders to restore communism.