Want to know:
salir (yo) salgo(tú) (sales)(él/ella/usted) (sale)(nosotros/nosotras) (salimos)(vosotros/vosotras) (salís)(ellos/ellas/ustedes) (salen)
Get a detailed, AI-powered explanation for this question and thousands more on StudyFetch.
Get the Answer for FreeHow StudyFetch Helps You Master This Topic
AI-Powered Answers
Get instant, detailed explanations powered by AI that understands your course material.
Deep Understanding
Go beyond surface-level answers with step-by-step breakdowns and examples.
Personalized Learning
Sparky adapts to your learning style and helps you connect ideas.
Practice & Test
Turn any question into flashcards, quizzes, and practice tests to solidify your knowledge.
Explore More Questions
- Given the mRNA sequence below, what polypeptide sequence could be formed? (4 points)AUCUUUGUAUGGGUACACGUUAUUGGUUAUAGAUCCCAUCGG
- for words WITHOUT a written tilde:1. if a word ends in n, s, or a vowel (vocal), the word is ______ and the stress falls on the __________
- t/f: diffusion continues once a solution is set at equilibrium