Want to know:
A researcher interested in the control of the cell cycle identifies a yeast mutant (cd-) whose rate of cell division is temperature sensitive. At low, permissive temperatures, the mutant strain grows normally and produces yeast colonies having a normal size. However, at elevated, restrictive temperatures, the mutant strain is unable to divide and produces no colonies. She has a yeast genomic library made in a plasmid vector (containing the ura3+ selectable marker) and a ura3- cd- mutant, and she wants to clone the gene affected in the cell division mutant.What steps should she take to accomplish this objective?
Get a detailed, AI-powered explanation for this question and thousands more on StudyFetch.
Get the Answer for FreeHow StudyFetch Helps You Master This Topic
AI-Powered Answers
Get instant, detailed explanations powered by AI that understands your course material.
Deep Understanding
Go beyond surface-level answers with step-by-step breakdowns and examples.
Personalized Learning
Sparky adapts to your learning style and helps you connect ideas.
Practice & Test
Turn any question into flashcards, quizzes, and practice tests to solidify your knowledge.
Explore More Questions
- 9.3 A dot plot provides a straightforward way to identifysimilar regions in pairs of sequences. In a dot plot, onesequence is written along the X-axis on a sheet of graph paper, and the second sequence is written along the Yaxis. A dot is placed in the plot whenever the nucleotidein a column on the X-axis matches the nucleotide in a row on the Y-axis.a. Construct a dot plot for each of the following pairs ofsequences, and then state where the plot reveals regionsof similarity between each pair of sequences.i. GCATTTAGAGCCCTAGTCGTGACAGATTCAGTTAGAGCCCTAGCTGATTGCii. AGCGATTGGTCCTGTACGAGCTAAGATGCACCTGTACGAGCCTTAb. Consider the results of your dot plots. What are someof the issues that the BLAST program, which performssequence similarity searches between a querysequence and sequences in a database, must address?
- When choosing a command line bioformatics which of the following should be a consideration?a. the applicationb. further analysis to be preformedc. source of dataD. all of these are considerations
- 9.12 Describe the steps you would take to obtain a null allele in your favorite yeast gene (YFG) using homologous recombination if you have available a yeast strain that is sensitive to the antibiotic kanamycin, pBluescript II plasmids (see Chapter 8, p. 176) with the DNA inserts diagrammed in Figure 9.B, and are able to transform yeast with a targeting vector, once you construct it. In Figure 9.B, EcoRI, HaeII, HindIII, and PstI are restriction enzymes (see Chapter 8, p. 174) that cleave these DNAs at the sites shown, and the distances between the sites aregiven in kb. As part of your answer, diagram the targeting vector you would construct and the structure of the chromosomal region once YFG is knocked out using this targeting vector. Also, describe how you would use PCR to confirm that you had obtained a null allele at the gene, and indicate on your diagrams the regions you would use for designing PCR primers. Remember that the absence of a PCR product does not provide strong evidence for a specific DNA arrangement, as a PCR could fail for any number of reasons.